a) Comparison matrix: PAM40
Number of alignments computed: 2
Gap open penalty: 10
Gap extension penalty: 3
100.0% identity in 4 residues overlap; Score: 28.0; Gap frequency: 0.0%
UserSeq1, 1 HASE
UserSeq2, 6 HASE
****
66.7% identity in 3 residues overlap; Score: 14.0; Gap frequency: 0.0%
UserSeq1, 8 ATE
UserSeq2, 7 ASE
* *
b) Comparison matrix: PAM250
Number of alignments computed: 2
Gap open penalty: 10
Gap extension penalty: 3
100.0% identity in 4 residues overlap; Score: 14.0; Gap frequency: 0.0%
UserSeq1, 1 HASE
UserSeq2, 6 HASE
****
16.7% identity in 6 residues overlap; Score: 10.0; Gap frequency: 0.0%
UserSeq1, 6 BRATEN
UserSeq2, 4 ERHASE
*
Zurück zur Übung 2.1
SEVERAL: 3 matches found in 3 entries
NEIN: 398 matches found in 396 entries.
Zurück zur Übung 2.2
Weiter zur Übung 2.3
Lösung 2.3
2.3.a)
Score E
Sequences producing significant alignments:
(bits) Value
emb|Z29337|MVVIRPR Marburg virus (Popp) NP,
VP35, VP40, GP, VP3... 123 3e-27
gb|M72714|MRVNUCPRO Marburg virus nucleoprotein
gene, complete ... 123 3e-27
emb|Z12132|MVREPCYC Marburg virus genes for
vp35, vp40, vp30, v... 123 3e-27
emb|X68495|MAVSPAC Marburg Virus genomic RNA
of NP gene
123 3e-27
gb|U64851|CELF28A12 Caenorhabditis elegans
cosmid F28A12
40 0.031
gb|AC002041|HUAC002041 Human Chromosome 16
BAC clone CIT987SK-A... 40 0.031
gb|AC004685|HUAC004685 Homo sapiens Chromosome
16 BAC clone CIT... 36 0.49
emb|AL021408|HS523C21 Homo sapiens DNA sequence
from PAC 523C21... 34 1.9
gb|AF050491|MTAHR2 Microgadus tomcod aromatic
hydrocarbon recep... 34 1.9
emb|Z68277|HSL196E3 Human DNA sequence from
cosmid L196E3, Hunt... 34 1.9
Das Marburg Virus hat mit großem Abstand die größte
Signifikanz.
2.3.b)
Der BLAST SEARCH für die Sequenz mit Deletion (nb) liefert als
besten Eintrag:
gb|AE001175|AE001175
Borrelia burgdorferi (section 61 of 70) of the complete genome
Length = 11011
Score = 46.1 bits (23), Expect = 5e-04
Identities = 23/23 (100%), Positives = 23/23
(100%)
Query: 39 tgttgacaataattattctttta 61
|||||||||||||||||||||||
Sbjct: 5177 tgttgacaataattattctttta 5199
Score = 34.2 bits (17), Expect = 1.8
Identities = 17/17 (100%), Positives = 17/17
(100%)
Query: 1 aatattttcttttgtgt 17
|||||||||||||||||
Sbjct: 5139 aatattttcttttgtgt 5155
Der BLAST Search der unveränderten Sequenz liefert:
emb|X57295|AMTAP1G A. majus tap1 gene for TAP1
Length = 5280
Score = 75.8 bits (38), Expect = 5e-13
Identities = 38/38 (100%), Positives = 38/38
(100%)
Query: 1 aatattttcttttgtgtaatttcgaatttaattgtagt
38
||||||||||||||||||||||||||||||||||||||
Sbjct: 1178 aatattttcttttgtgtaatttcgaatttaattgtagt
1141
Das Gen stammt vom garden snapdragon(1178-1162), die Hybridsequenz hatte den stärkeren Hit.
Suche mit altavista (http://www.altavista.com/) nach snapdragon.
(http://www.1stinflowers.com/faq20.html
, http://www.lowes.com/frames/howto/library/lawngard/annuals/snapdrgn.htm)
Zurück zur Übung 2.3
Weiter zur Übung 2.4
Lösung 2.4
2.4.1) Alignment von Eco R1
Die Sequenz hat eine Länge von 276 Aminosäuren und wurde mit FASTA gegen die SwissProt und die SwissProtAll Datenbank aligned.
a) Im Swissprot Alignment wurden fünf beste Alignments ausgesucht:
The best scores are:
initn init1 opt z-sc E(73844)
SW:T2E1_ECOLI P00642 escherichia coli. t (
276) 1779 1779 1779 2013.9 1.7e-105
SW:T2R1_RHOSH P21763 rhodobacter sphaero (
276) 819 794 863 981.9 5.1e-48
SW:HRCA_CLOAB P30727 clostridium acetobu (
343) 46 46 126 150.2 0.11
SW:Y948_METJA Q58358 methanococcus janna (
191) 40 40 96 120.3 5.1
SW:MTC1_CITFR Q04845 citrobacter freundi (
376) 75 75 99 119.2 5.8
b) Im SwissProtAll Alignment wurde ein geringfügig anderes Resultat gefunden:
The best scores are:
initn init1 opt z-sc E(281811)
SWALL:T2E1_ECOLI P00642 TYPE II RESTRICT (
276) 1779 1779 1779 2007.3 1.5e-104
SWALL:T2R1_RHOSH P21763 TYPE II RESTRICT (
276) 819 794 863 978.8 2.9e-47
SWALL:HRCA_CLOAB P30727 HEAT-INDUCIBLE T (
343) 46 46 126 149.8 0.44
SWALL:O45419 O45419 F31D4.4. 11/98
( 333) 32 32 118 141.0 1.3
SWALL:O48644 O48644 RD22BP1. 11/98
( 623) 65 65 111 129.0 6.3
Zu diesem Alignment liegt auch ein Histogramm
vor.
Zurück zur Übung 2.4
Weiter zur Übung 2.5