Lösung 2.1
a) Comparison matrix: PAM40
Number of alignments computed: 2
Gap open penalty: 10
Gap extension penalty: 3
100.0% identity in 4 residues overlap; Score: 28.0; Gap frequency: 0.0%
UserSeq1,      1 HASE
UserSeq2,      6 HASE
                 ****
66.7% identity in 3 residues overlap; Score: 14.0; Gap frequency: 0.0%
UserSeq1,      8 ATE
UserSeq2,      7 ASE
                 * *
b) Comparison matrix: PAM250
Number of alignments computed: 2
Gap open penalty: 10
Gap extension penalty: 3
100.0% identity in 4 residues overlap; Score: 14.0; Gap frequency: 0.0%
UserSeq1,      1 HASE
UserSeq2,      6 HASE
                 ****
16.7% identity in 6 residues overlap; Score: 10.0; Gap frequency: 0.0%
UserSeq1,      6 BRATEN
UserSeq2,      4 ERHASE
                  *
Zurück zur Übung 2.1
Weiter zur Übung 2.2

Lösung 2.2

SEVERAL: 3 matches found in 3 entries
NEIN: 398 matches found in 396 entries.
 

Zurück zur Übung 2.2
Weiter zur Übung 2.3

Lösung 2.3
2.3.a)                                                                 Score     E
Sequences producing significant alignments:                        (bits)  Value

emb|Z29337|MVVIRPR  Marburg virus (Popp) NP, VP35, VP40, GP, VP3...   123  3e-27
gb|M72714|MRVNUCPRO  Marburg virus nucleoprotein gene, complete ...   123  3e-27
emb|Z12132|MVREPCYC  Marburg virus genes for vp35, vp40, vp30, v...   123  3e-27
emb|X68495|MAVSPAC  Marburg Virus genomic RNA of NP gene              123  3e-27
gb|U64851|CELF28A12  Caenorhabditis elegans cosmid F28A12              40  0.031
gb|AC002041|HUAC002041  Human Chromosome 16 BAC clone CIT987SK-A...    40  0.031
gb|AC004685|HUAC004685  Homo sapiens Chromosome 16 BAC clone CIT...    36  0.49
emb|AL021408|HS523C21  Homo sapiens DNA sequence from PAC 523C21...    34  1.9
gb|AF050491|MTAHR2  Microgadus tomcod aromatic hydrocarbon recep...    34  1.9
emb|Z68277|HSL196E3  Human DNA sequence from cosmid L196E3, Hunt...    34  1.9

Das Marburg Virus hat mit großem Abstand die größte Signifikanz.
 

2.3.b)
Der BLAST SEARCH für die Sequenz mit Deletion (nb) liefert als besten Eintrag:

 gb|AE001175|AE001175 Borrelia burgdorferi (section 61 of 70) of the complete genome
            Length = 11011

 Score = 46.1 bits (23), Expect = 5e-04
 Identities = 23/23 (100%), Positives = 23/23 (100%)
 

Query: 39   tgttgacaataattattctttta 61
            |||||||||||||||||||||||
Sbjct: 5177 tgttgacaataattattctttta 5199
 

 Score = 34.2 bits (17), Expect = 1.8
 Identities = 17/17 (100%), Positives = 17/17 (100%)
 

Query: 1    aatattttcttttgtgt 17
            |||||||||||||||||
Sbjct: 5139 aatattttcttttgtgt 5155
 

Der BLAST Search der unveränderten Sequenz liefert:

 emb|X57295|AMTAP1G A. majus tap1 gene for TAP1
            Length = 5280

 Score = 75.8 bits (38), Expect = 5e-13
 Identities = 38/38 (100%), Positives = 38/38 (100%)
 

Query: 1    aatattttcttttgtgtaatttcgaatttaattgtagt 38
            ||||||||||||||||||||||||||||||||||||||
Sbjct: 1178 aatattttcttttgtgtaatttcgaatttaattgtagt 1141
 

Das Gen stammt vom  garden snapdragon(1178-1162), die Hybridsequenz hatte den stärkeren Hit.

Suche mit altavista (http://www.altavista.com/) nach snapdragon.

(http://www.1stinflowers.com/faq20.html , http://www.lowes.com/frames/howto/library/lawngard/annuals/snapdrgn.htm)
 

Zurück zur Übung 2.3
Weiter zur Übung 2.4

Lösung 2.4
 

2.4.1) Alignment von Eco R1

Die Sequenz hat eine Länge von 276 Aminosäuren und wurde mit FASTA gegen die SwissProt und die SwissProtAll Datenbank aligned.

a) Im Swissprot Alignment wurden fünf beste Alignments ausgesucht:

The best scores are:                             initn init1 opt z-sc E(73844)
SW:T2E1_ECOLI P00642 escherichia coli. t  ( 276) 1779 1779 1779 2013.9 1.7e-105
SW:T2R1_RHOSH P21763 rhodobacter sphaero  ( 276)  819  794  863 981.9 5.1e-48
SW:HRCA_CLOAB P30727 clostridium acetobu  ( 343)   46   46  126 150.2 0.11
SW:Y948_METJA Q58358 methanococcus janna  ( 191)   40   40   96 120.3  5.1
SW:MTC1_CITFR Q04845 citrobacter freundi  ( 376)   75   75   99 119.2  5.8
 
 

b) Im  SwissProtAll Alignment wurde ein geringfügig anderes Resultat gefunden:

The best scores are:                             initn init1 opt z-sc E(281811)
SWALL:T2E1_ECOLI P00642 TYPE II RESTRICT  ( 276) 1779 1779 1779 2007.3 1.5e-104
SWALL:T2R1_RHOSH P21763 TYPE II RESTRICT  ( 276)  819  794  863 978.8 2.9e-47
SWALL:HRCA_CLOAB P30727 HEAT-INDUCIBLE T  ( 343)   46   46  126 149.8 0.44
SWALL:O45419 O45419 F31D4.4. 11/98        ( 333)   32   32  118 141.0  1.3
SWALL:O48644 O48644 RD22BP1. 11/98        ( 623)   65   65  111 129.0  6.3

Zu diesem Alignment liegt auch ein  Histogramm  vor.

Zurück zur Übung 2.4
Weiter zur Übung 2.5